missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10590091

Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer

Product Code. 10590091 Shop All Thermo Scientific Products
Change view
Click to view available options
Quantity:
10 μM
Unit Size:
Each
Product Code. Quantity unitSize
10590091 10 μM Each
1 options
This item is not returnable. View return policy

Product Code. 10590091

Brand: Thermo Scientific™ SO501

Please to purchase this item. Need a web account? Register with us today!

This item is not returnable. View return policy

Description

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)

TRUSTED_SUSTAINABILITY

Specifications

Product Type Forward Sequencing Primer
Content And Storage T3 promoter Sequencing Primer, 24-mer, 10 μM

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer pJET
Quantity 10 μM
Vector pJET1.2
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.